Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05485
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209206
Product ID ORK05485
Clone name fj06551
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IDH3G
cDNA sequence DNA sequence (4197 bp)
Predicted protein sequence (174 aa)
Description Isocitrate dehydrogenase [NAD] subunit gamma, mitochondrial precursor (EC 1.1.1.41) (Isocitric dehydrogenase) (NAD(+)-specific ICDH).
Features of the cloned cDNA sequence

Length: 4197 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 380 bp
Genome contig ID gi89161218r_152604418
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
GGTACGCAGATCCCAGAATAAAGCACCTTCTCCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACTTGGCGTGGGCCTCCCTCACTCCAGGCACCGATGTTCAGTCCACAC

Features of the protein sequence

Length: 174 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92443 6.4e-73 100.0 isocitrate dehy...
Homo sapiens
AAB70115 2.1e-65 92.9 NAD (H)-specifi...
Homo sapiens
EAW72794 2.2e-65 92.9 hCG2004980, iso...
Homo sapiens
NP_777358 2.5e-65 92.9 isocitrate dehy...
Homo sapiens
EAW72797 8.9e-56 90.2 hCG2004980, iso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001804 20 148 PF00180 Isocitrate/isopropylmalate dehydrogenase
ScanRegExp IPR001804 68 87 PS00470 Isocitrate/isopropylmalate dehydrogenase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp