ORK05495

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05495

Order Kazusa clone(s) from :

Accession No	AB209668
Product ID	ORK05495
Clone name	pf02494
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	IGF2R
cDNA sequence	DNA sequence (7662 bp) Predicted protein sequence (2414 aa)
Description	Cation-independent mannose-6-phosphate receptor precursor (CI Man-6-P receptor) (CI-MPR) (M6PR) (Insulin-like growth factor 2 receptor) (Insulin-like growth factor II receptor) (IGF-II receptor) (M6P/IGF2 receptor) (M6P/IGF2R) (300 kDa mannose 6-phosphate

Features of the cloned cDNA sequence

Description

Length: 7662 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	415 bp
Genome contig ID	gi89161210f_160232286
PolyA signal sequence (None)	+--------+--------+----*----+---- CTATTTATTGACTTTGACAATTACTCAGGTTTGAG
Flanking genome sequence (214237 - 214286)	----+--------+--------+--------+--------+----* AAAAAGGAAAAAAAAACAGCCACCGTTTCTTCCTGCCAGCAGGGGTGTGA

Features of the protein sequence

Description

Length: 2414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92905	100.0	Insulin-like gr...	Homo sapiens
P11717	99.9	Cation-independ...	Homo sapiens
AAK56918	99.9	IGF2R [Homo sap...	Homo sapiens
CAA68395	99.8	unnamed protein...	Homo sapiens
AAA59866	99.4	mannose 6-phosp...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000562	1820	1865	PD000995	Type II fibronectin
FPrintScan	IPR000562	1823	1832	PR00013	Type II fibronectin
	IPR000562	1834	1846	PR00013	Type II fibronectin
	IPR000562	1849	1864	PR00013	Type II fibronectin
HMMPfam	IPR000479	46	194	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	200	344	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	346	496	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	498	639	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	643	799	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	954	1101	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	1102	1243	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	1245	1385	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	1388	1522	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	1526	1671	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	1678	1817	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000562	1826	1865	PF00040	Type II fibronectin
	IPR000479	1869	2006	PF00878	Cation-independent mannose-6-phosphate receptor
	IPR000479	2160	2202	PF00878	Cation-independent mannose-6-phosphate receptor
HMMSmart	IPR000562	1819	1865	SM00059	Type II fibronectin
ProfileScan	IPR000562	1821	1867	PS51092	Type II fibronectin
ScanRegExp	IPR000562	1826	1865	PS00023	Type II fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	2186	TADCQYLFSWYTSAVCPLGVGF	2207	SECONDARY	22
SOSUI2	2	2228	AVGAVLSLLLVALTCCLLALLLY	2250	PRIMARY	23