Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05515
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209062
Product ID ORK05515
Clone name hk00208
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol ILF3
cDNA sequence DNA sequence (4230 bp)
Predicted protein sequence (450 aa)
Description Interleukin enhancer-binding factor 3 (Nuclear factor of activated T- cells 90 kDa) (NF-AT-90) (Double-stranded RNA-binding protein 76) (DRBP76) (Translational control protein 80) (TCP80) (Nuclear factor associated with dsRNA) (NFAR) (M-phase phosphoprote
Features of the cloned cDNA sequence

Length: 4230 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2630 bp
Genome contig ID gi42406306f_10525980
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AGCTGAATGTAGACAAATAAAGAAAAACAAAACTG
Flanking genome sequence
(135545 - 135594)
----+----*----+----*----+----*----+----*----+----*
CGCCCGTCTTAGGCCTGGGTGTCTGACCCACCAGCAGTGCAATGGGCAGG

Features of the protein sequence

Length: 450 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92299 1.4e-182 100.0 interleukin enh...
Homo sapiens
CAA66917 2.8e-158 100.0 M-phase phospho...
Homo sapiens
CAC01406 4e-158 100.0 double-stranded...
Homo sapiens
XP_001166193 4e-158 100.0 interleukin enh...
Pan troglodytes
XP_001166283 4.1e-158 100.0 interleukin enh...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR006561 103 351 PF07528 DZF
HMMSmart IPR006561 97 351 SM00572 DZF
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp