ORK05520

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05520

Order Kazusa clone(s) from :

Accession No	AB208861
Product ID	ORK05520
Clone name	fk05451
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	INSR
cDNA sequence	DNA sequence (3419 bp) Predicted protein sequence (833 aa)
Description	Insulin receptor precursor (EC 2.7.10.1) (IR) (CD220 antigen) [Contains: Insulin receptor subunit alpha; Insulin receptor subunit beta].

Features of the cloned cDNA sequence

Description

Length: 3419 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	917 bp
Genome contig ID	gi42406306r_6967150
PolyA signal sequence (None)	+--------+--------+----*----+---- TGAATCTTTTCAAGACCAAACCAAGCTAGGACATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAGAAAAAGAAAGAAAAAACAAAATGGAAAAAGGAAAAA

Features of the protein sequence

Description

Length: 833 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92098	100.0	insulin recepto...	Homo sapiens
EAW69047	100.0	insulin recepto...	Homo sapiens
AAI17173	100.0	Insulin recepto...	Homo sapiens
NP_001073285	100.0	insulin recepto...	Homo sapiens
CAA26096	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	480	734	PD000001	Protein kinase
FPrintScan	IPR001245	554	567	PR00109	Tyrosine protein kinase
	IPR001245	600	618	PR00109	Tyrosine protein kinase
	IPR001245	649	659	PR00109	Tyrosine protein kinase
	IPR001245	668	690	PR00109	Tyrosine protein kinase
	IPR001245	712	734	PR00109	Tyrosine protein kinase
HMMPfam	IPR003961	85	122	PF00041	Fibronectin
	IPR003961	305	388	PF00041	Fibronectin
	IPR001245	474	741	PF07714	Tyrosine protein kinase
HMMSmart	IPR003961	85	282	SM00060	Fibronectin
	IPR003961	302	385	SM00060	Fibronectin
	IPR001245	474	741	SM00219	Tyrosine protein kinase
	IPR002290	474	749	SM00220	Serine/threonine protein kinase
ProfileScan	IPR003961	85	158	PS50853	Fibronectin
	IPR003961	301	397	PS50853	Fibronectin
	IPR000719	474	749	PS50011	Protein kinase
ScanRegExp	IPR000719	480	508	PS00107	Protein kinase
	IPR008266	606	618	PS00109	Tyrosine protein kinase
	IPR002011	634	642	PS00239	Receptor tyrosine kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	403	SNIAKIIIGPLIFVFLFSVVIGS	425	PRIMARY	23