Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05529
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208856
Product ID ORK05529
Clone name fj15811
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol IQGAP2
cDNA sequence DNA sequence (4282 bp)
Predicted protein sequence (1155 aa)
Description Ras GTPase-activating-like protein IQGAP2.
Features of the cloned cDNA sequence

Length: 4282 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 814 bp
Genome contig ID gi51511721f_75837788
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATTGTTTTATGTAAAATAAATGTTACTTAATTCC
Flanking genome sequence
(201922 - 201971)
----+----*----+----*----+----*----+----*----+----*
ATTAATTTGGCTTTTAAGTTGTCTTAATAAATCAAAGTCATTTAGTGGGT

Features of the protein sequence

Length: 1155 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92093 0 100.0 IQ motif contai...
Homo sapiens
EAW95776 0 100.0 IQ motif contai...
Homo sapiens
EAW95775 0 100.0 IQ motif contai...
Homo sapiens
NP_006624 0 99.9 ras GTPase-acti...
Homo sapiens
Q13576 0 99.8 Ras GTPase-acti...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000593 951 1154 PD008735 RasGAP protein
HMMPfam IPR000048 271 291 PF00612 IQ calmodulin-binding region
IPR000048 301 321 PF00612 IQ calmodulin-binding region
IPR000048 331 351 PF00612 IQ calmodulin-binding region
IPR001936 518 730 PF00616 Ras GTPase-activating protein
IPR000593 946 1081 PF03836 RasGAP protein
HMMSmart IPR000048 269 291 SM00015 IQ calmodulin-binding region
IPR000048 299 321 SM00015 IQ calmodulin-binding region
IPR000048 329 351 SM00015 IQ calmodulin-binding region
IPR001936 485 838 SM00323 Ras GTPase-activating protein
ProfileScan IPR001202 174 207 PS50020 WW/Rsp5/WWP
IPR000048 270 299 PS50096 IQ calmodulin-binding region
IPR000048 300 329 PS50096 IQ calmodulin-binding region
IPR000048 330 359 PS50096 IQ calmodulin-binding region
IPR001936 497 730 PS50018 Ras GTPase-activating protein
ScanRegExp IPR001202 180 205 PS01159 WW/Rsp5/WWP
IPR001005 237 245 PS00037 SANT
IPR001936 682 696 PS00509 Ras GTPase-activating protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp