ORK05547

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05547

Order Kazusa clone(s) from :

Accession No	AB209894
Product ID	ORK05547
Clone name	eg01636
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ITGAV
cDNA sequence	DNA sequence (6898 bp) Predicted protein sequence (1098 aa)
HaloTag ORF Clone	FHC05547
Flexi ORF Clone	FXC05547
Description	Integrin alpha-V precursor (Vitronectin receptor subunit alpha) (CD51 antigen) [Contains: Integrin alpha-V heavy chain; Integrin alpha-V light chain].

Features of the cloned cDNA sequence

Description

Length: 6898 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3600 bp
Genome contig ID	gi89161199f_187063052
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AACTTGTGACTGTACAATAAACATAAGCATATGGT
Flanking genome sequence (190819 - 190868)	----+--------+--------+--------+--------+----* ACCACTTTTGTGTATGGGGTTTATCCTTTCTGTGACGTGTTTTTGTTTTT

Features of the protein sequence

Description

Length: 1098 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD93131	100.0	integrin alpha-...	Homo sapiens
CAM13679	92.1	integrin alpha ...	Mus musculus
XP_545559	94.9	similar to Inte...	Canis lupus fam...
AAA36808	96.4	vitronectin alp...	Homo sapiens
XP_515967	96.5	integrin alpha-...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000413	299	311	PR01185	Integrins alpha chain
	IPR000413	318	329	PR01185	Integrins alpha chain
	IPR000413	349	369	PR01185	Integrins alpha chain
	IPR000413	419	443	PR01185	Integrins alpha chain
	IPR000413	484	505	PR01185	Integrins alpha chain
	IPR000413	511	530	PR01185	Integrins alpha chain
	IPR000413	630	643	PR01185	Integrins alpha chain
	IPR000413	1054	1073	PR01185	Integrins alpha chain
HMMPfam	IPR013517	302	336	PF01839	FG-GAP
	IPR013517	356	398	PF01839	FG-GAP
	IPR013517	420	456	PF01839	FG-GAP
	IPR013649	517	964	PF08441	Integrin alpha-2
	IPR013513	1067	1081	PF00357	Integrin alpha chain
HMMSmart	IPR013519	131	190	SM00191	Integrin alpha beta-propellor
	IPR013519	298	348	SM00191	Integrin alpha beta-propellor
	IPR013519	352	413	SM00191	Integrin alpha beta-propellor
	IPR013519	416	472	SM00191	Integrin alpha beta-propellor
	IPR013519	480	534	SM00191	Integrin alpha beta-propellor
ScanRegExp	IPR013513	1066	1073	PS00242	Integrin alpha chain

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1044	VWVIILAVLAGLLLLAVLVFVMY	1066	PRIMARY	23