ORK05550

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05550

Order Kazusa clone(s) from :

Accession No	AB209388
Product ID	ORK05550
Clone name	fh20163
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ITIH4
cDNA sequence	DNA sequence (5455 bp) Predicted protein sequence (699 aa)
Description	Inter-alpha-trypsin inhibitor heavy chain H4 precursor (ITI heavy chain H4) (Inter-alpha-inhibitor heavy chain 4) (Inter-alpha-trypsin inhibitor family heavy chain-related protein) (IHRP) (Plasma kallikrein sensitive glycoprotein 120) (PK-120) (GP120) [Co

Features of the cloned cDNA sequence

Description

Length: 5455 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2119 bp
Genome contig ID	gi89161205r_52722047
PolyA signal sequence (AATAGA,-9)	+--------+--------+----*----+---- TTGACTACAAAAAAAAAAAAAAAAAAAATAGAGTG
Flanking genome sequence (99973 - 99924)	----+--------+--------+--------+--------+----* AACTGGGTTGGAATTCTTTCTAGTCCAACTCCTAAACTTTCTCAGTGAGC

Features of the protein sequence

Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92625	100.0	inter-alpha (gl...	Homo sapiens
EAW65265	99.6	inter-alpha (gl...	Homo sapiens
XP_001172688	98.4	similar to PK-1...	Pan troglodytes
XP_001172675	98.4	similar to PK-1...	Pan troglodytes
CAH93116	96.2	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002035	258	275	PR00453	von Willebrand factor
FPrintScan	IPR002035	364	372	PR00453	von Willebrand factor
HMMPfam	IPR013694	16	133	PF08487	Vault protein inter-alpha-trypsin
HMMPfam	IPR002035	259	442	PF00092	von Willebrand factor
HMMSmart	IPR006587	6	133	SM00609	Vault protein inter-alpha-trypsin
HMMSmart	IPR002035	257	441	SM00327	von Willebrand factor
ProfileScan	IPR002035	259	442	PS50234	von Willebrand factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp