Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05821
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209391
Product ID ORK05821
Clone name fh20918
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol LGALS3
cDNA sequence DNA sequence (5021 bp)
Predicted protein sequence (258 aa)
Description Galectin-3 (Galactose-specific lectin 3) (Mac-2 antigen) (IgE-binding protein) (35 kDa lectin) (Carbohydrate-binding protein 35) (CBP 35) (Laminin-binding protein) (Lectin L-29) (L-31) (Galactoside-binding protein) (GALBP).
Features of the cloned cDNA sequence

Length: 5021 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 137 bp
Genome contig ID gi51511730f_54569595
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
TCTTGTAAGTCATCTACTTAATAAATATTACAGTG
Flanking genome sequence
(112286 - 112335)
----+----*----+----*----+----*----+----*----+----*
AATTACCTGTCTCAATATGTCATTTAATTGGAGTGGTTTATTCTAGATAA

Features of the protein sequence

Length: 258 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92628 3.4e-73 100.0 LGALS3 protein ...
Homo sapiens
EAW80659 4.9e-69 96.4 hCG22119, isofo...
Homo sapiens
AAB26229 6.4e-69 99.1 carbohydrate bi...
Homo sapiens
EAW80661 6.7e-69 99.1 hCG22119, isofo...
Homo sapiens
AAA88086 1.2e-68 98.7 galactose-speci...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001079 125 255 PF00337 Galectin
HMMSmart IPR001079 124 256 SM00276 Galectin
ScanRegExp IPR001079 189 208 PS00309 Galectin
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp