ORK05828

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05828

Order Kazusa clone(s) from :

Accession No	AB208791
Product ID	ORK05828
Clone name	hk03621
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	LIG1
cDNA sequence	DNA sequence (4102 bp) Predicted protein sequence (832 aa)
Description	DNA ligase 1 (EC 6.5.1.1) (DNA ligase I) (Polydeoxyribonucleotide synthase [ATP] 1).

Features of the cloned cDNA sequence

Description

Length: 4102 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1556 bp
Genome contig ID	gi42406306r_53210519
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATCCCGTCATTTCTTTCAATAAATAATTATCGGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCTACTTTGTGACAGGGTCTGTGCTGGGCTCTGGGGGCAAAGCTGTCAT

Features of the protein sequence

Description

Length: 832 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92028	100.0	DNA ligase I va...	Homo sapiens
AAI10623	99.8	LIG1 protein [H...	Homo sapiens
P18858	99.7	DNA ligase 1; D...	Homo sapiens
XP_001170063	98.7	DNA ligase I is...	Pan troglodytes
XP_001170145	98.6	DNA ligase I is...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012308	318	496	PF04675	DNA ligase
	IPR012310	573	777	PF01068	ATP dependent DNA ligase
	IPR012309	802	827	PF04679	ATP dependent DNA ligase
HMMTigr	IPR000977	377	830	TIGR00574	ATP-dependent DNA ligase
ProfileScan	IPR012310	679	815	PS50160	ATP dependent DNA ligase
ScanRegExp	IPR000977	597	605	PS00697	ATP-dependent DNA ligase
ScanRegExp	IPR000977	751	777	PS00333	ATP-dependent DNA ligase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp