Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05895
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209865
Product ID ORK05895
Clone name ef03457
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol LTBP2
cDNA sequence DNA sequence (7803 bp)
Predicted protein sequence (1700 aa)
Description Latent-transforming growth factor beta-binding protein 2 precursor (LTBP-2).
Features of the cloned cDNA sequence

Length: 7803 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2700 bp
Genome contig ID gi51511730r_73934640
PolyA signal sequence
(AATAAA,-20)		 
+----*----+----*----+----*----+----
CACCTATTCAAAAAAAATAAAATATTTTTAAATAC
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGTTGCTGGCCAAAGATTGCTTAAATGCTCCTTCTCTTTATATATTTATC

Features of the protein sequence

Length: 1700 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93102 0 100.0 latent transfor...
 Homo sapiens
AAB37459 0 99.9 latent transfor...
 Homo sapiens
AAH78659 0 99.8 Latent transfor...
 Homo sapiens
Q14767 0 99.8 Latent-transfor...
 Homo sapiens
CAA86030 0 99.7 LTBP-2 precurso...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013111 70 97 PF07974 EGF
IPR002212 440 475 PF00683 Matrix fibril-associated
IPR013091 501 540 PF07645 EGF calcium-binding
IPR002212 560 602 PF00683 Matrix fibril-associated
IPR006209 727 764 PF00008 EGF-like
IPR006209 770 804 PF00008 EGF-like
IPR013091 809 847 PF07645 EGF calcium-binding
IPR013091 849 887 PF07645 EGF calcium-binding
IPR013091 889 928 PF07645 EGF calcium-binding
IPR013091 930 970 PF07645 EGF calcium-binding
IPR013091 972 1012 PF07645 EGF calcium-binding
IPR013091 1014 1053 PF07645 EGF calcium-binding
IPR013091 1055 1095 PF07645 EGF calcium-binding
IPR013091 1097 1136 PF07645 EGF calcium-binding
IPR013091 1138 1180 PF07645 EGF calcium-binding
IPR013091 1182 1222 PF07645 EGF calcium-binding
IPR013091 1224 1265 PF07645 EGF calcium-binding
IPR002212 1300 1341 PF00683 Matrix fibril-associated
IPR013091 1364 1405 PF07645 EGF calcium-binding
IPR006209 1411 1445 PF00008 EGF-like
IPR002212 1472 1514 PF00683 Matrix fibril-associated
IPR006209 1616 1651 PF00008 EGF-like
IPR013091 1653 1696 PF07645 EGF calcium-binding
HMMSmart IPR006210 69 98 SM00181 EGF
IPR006210 278 307 SM00181 EGF
IPR001881 501 541 SM00179 EGF-like calcium-binding
IPR006210 504 541 SM00181 EGF
IPR001881 723 765 SM00179 EGF-like calcium-binding
IPR006210 726 765 SM00181 EGF
IPR001881 766 808 SM00179 EGF-like calcium-binding
IPR006210 769 808 SM00181 EGF
IPR001881 809 848 SM00179 EGF-like calcium-binding
IPR006210 812 848 SM00181 EGF
IPR001881 849 888 SM00179 EGF-like calcium-binding
IPR006210 852 888 SM00181 EGF
IPR001881 889 929 SM00179 EGF-like calcium-binding
IPR006210 892 929 SM00181 EGF
IPR001881 930 971 SM00179 EGF-like calcium-binding
IPR006210 933 971 SM00181 EGF
IPR001881 972 1013 SM00179 EGF-like calcium-binding
IPR006210 975 1013 SM00181 EGF
IPR001881 1014 1054 SM00179 EGF-like calcium-binding
IPR006210 1017 1054 SM00181 EGF
IPR001881 1055 1096 SM00179 EGF-like calcium-binding
IPR006210 1058 1096 SM00181 EGF
IPR001881 1097 1137 SM00179 EGF-like calcium-binding
IPR006210 1100 1137 SM00181 EGF
IPR001881 1138 1181 SM00179 EGF-like calcium-binding
IPR006210 1141 1181 SM00181 EGF
IPR001881 1182 1223 SM00179 EGF-like calcium-binding
IPR006210 1185 1223 SM00181 EGF
IPR001881 1224 1266 SM00179 EGF-like calcium-binding
IPR006210 1227 1266 SM00181 EGF
IPR001881 1364 1406 SM00179 EGF-like calcium-binding
IPR006210 1367 1406 SM00181 EGF
IPR001881 1407 1446 SM00179 EGF-like calcium-binding
IPR006210 1410 1446 SM00181 EGF
IPR001881 1612 1652 SM00179 EGF-like calcium-binding
IPR006210 1615 1652 SM00181 EGF
IPR001881 1653 1697 SM00179 EGF-like calcium-binding
IPR006210 1656 1697 SM00181 EGF
ProfileScan IPR000742 66 98 PS50026 EGF-like
IPR000742 275 307 PS50026 EGF-like
IPR000742 501 541 PS50026 EGF-like
IPR000742 723 765 PS50026 EGF-like
IPR000742 766 802 PS50026 EGF-like
IPR000742 809 848 PS50026 EGF-like
IPR000742 889 929 PS50026 EGF-like
IPR000742 1014 1054 PS50026 EGF-like
IPR000742 1055 1096 PS50026 EGF-like
IPR000742 1097 1132 PS50026 EGF-like
IPR000742 1182 1223 PS50026 EGF-like
IPR000742 1364 1406 PS50026 EGF-like
IPR000742 1407 1442 PS50026 EGF-like
IPR000742 1612 1648 PS50026 EGF-like
IPR000742 1653 1697 PS50026 EGF-like
ScanRegExp IPR013032 86 97 PS00022 EGF-like region
IPR013032 86 97 PS01186 EGF-like region
IPR013032 295 306 PS00022 EGF-like region
IPR001881 501 525 PS01187 EGF-like calcium-binding
IPR000152 516 527 PS00010 Aspartic acid and asparagine hydroxylation site
IPR000152 740 751 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 749 764 PS01186 EGF-like region
IPR001881 766 790 PS01187 EGF-like calcium-binding
IPR000152 781 792 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 809 833 PS01187 EGF-like calcium-binding
IPR000152 824 835 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 833 847 PS01186 EGF-like region
IPR001881 849 873 PS01187 EGF-like calcium-binding
IPR001881 889 913 PS01187 EGF-like calcium-binding
IPR000152 904 915 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 913 928 PS01186 EGF-like region
IPR001881 930 954 PS01187 EGF-like calcium-binding
IPR001881 972 996 PS01187 EGF-like calcium-binding
IPR001881 1014 1039 PS01187 EGF-like calcium-binding
IPR000152 1030 1041 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1039 1053 PS01186 EGF-like region
IPR001881 1055 1080 PS01187 EGF-like calcium-binding
IPR000152 1071 1082 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1080 1095 PS01186 EGF-like region
IPR001881 1097 1121 PS01187 EGF-like calcium-binding
IPR000152 1112 1123 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1121 1136 PS01186 EGF-like region
IPR001881 1138 1164 PS01187 EGF-like calcium-binding
IPR001881 1182 1207 PS01187 EGF-like calcium-binding
IPR000152 1198 1209 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1207 1222 PS01186 EGF-like region
IPR001881 1224 1249 PS01187 EGF-like calcium-binding
IPR000152 1240 1251 PS00010 Aspartic acid and asparagine hydroxylation site
IPR001881 1364 1390 PS01187 EGF-like calcium-binding
IPR000152 1381 1392 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1390 1405 PS01186 EGF-like region
IPR001881 1407 1430 PS01187 EGF-like calcium-binding
IPR000152 1421 1432 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1636 1651 PS01186 EGF-like region
IPR001881 1653 1681 PS01187 EGF-like calcium-binding
IPR000152 1672 1683 PS00010 Aspartic acid and asparagine hydroxylation site
IPR013032 1681 1696 PS01186 EGF-like region
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp