Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05921
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208805
Product ID ORK05921
Clone name pj01570
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MAP3K6
cDNA sequence DNA sequence (3786 bp)
Predicted protein sequence (1192 aa)
Description Mitogen-activated protein kinase kinase kinase 6 (EC 2.7.11.25) (Apoptosis signal-regulating kinase 2).
Features of the cloned cDNA sequence

Length: 3786 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 205 bp
Genome contig ID gi89161185r_27454264
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
CTACCAGACAAAGCGTATTAAACAGAACACTTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCTTTGTCCTGGCAATTTTGGAGGTGTATGGTGGGAGGGGTATCCTGG

Features of the protein sequence

Length: 1192 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92042 0 100.0 mitogen-activat...
Homo sapiens
EAX07758 0 99.2 mitogen-activat...
Homo sapiens
O95382 0 99.1 Mitogen-activat...
Homo sapiens
XP_513244 0 98.7 mitogen-activat...
Pan troglodytes
JE0363 0 98.9 mitogen-activat...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 557 809 PD000001 Protein kinase
HMMPfam IPR000719 557 810 PF00069 Protein kinase
HMMSmart IPR001245 552 808 SM00219 Tyrosine protein kinase
IPR002290 552 810 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 552 810 PS50011 Protein kinase
ScanRegExp IPR000719 558 581 PS00107 Protein kinase
IPR008271 671 683 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp