ORK05921

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05921

Order Kazusa clone(s) from :

Accession No	AB208805
Product ID	ORK05921
Clone name	pj01570
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MAP3K6
cDNA sequence	DNA sequence (3786 bp) Predicted protein sequence (1192 aa)
Description	Mitogen-activated protein kinase kinase kinase 6 (EC 2.7.11.25) (Apoptosis signal-regulating kinase 2).

Features of the cloned cDNA sequence

Description

Length: 3786 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	205 bp
Genome contig ID	gi89161185r_27454264
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- CTACCAGACAAAGCGTATTAAACAGAACACTTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCTTTGTCCTGGCAATTTTGGAGGTGTATGGTGGGAGGGGTATCCTGG

Features of the protein sequence

Description

Length: 1192 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92042	100.0	mitogen-activat...	Homo sapiens
EAX07758	99.2	mitogen-activat...	Homo sapiens
O95382	99.1	Mitogen-activat...	Homo sapiens
XP_513244	98.7	mitogen-activat...	Pan troglodytes
JE0363	98.9	mitogen-activat...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	557	809	PD000001	Protein kinase
HMMPfam	IPR000719	557	810	PF00069	Protein kinase
HMMSmart	IPR001245	552	808	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	552	810	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	552	810	PS50011	Protein kinase
ScanRegExp	IPR000719	558	581	PS00107	Protein kinase
ScanRegExp	IPR008271	671	683	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp