Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK05950
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226175
Product ID ORK05950
Clone name bm04567
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol MCM7
cDNA sequence DNA sequence (2514 bp)
Predicted protein sequence (591 aa)
Flexi ORF Clone FXC05950
Description DNA replication licensing factor MCM7 (CDC47 homolog) (P1.1-MCM3).
Features of the cloned cDNA sequence

Length: 2514 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 203 bp
Genome contig ID gi89161213r_99428288
PolyA signal sequence
(ATTAAA,-27)		 
+----*----+----*----+----*----+----
TGACTTCCATTAAAACAGGGTTTTGTGCGTTTTTT
Flanking genome sequence
(100000 - 99951)		 
----+----*----+----*----+----*----+----*----+----*
AGATTCCTGTTCGTTTTTATGCTATTTCATCCACTCAGTAAATTACCTGA

Features of the protein sequence

Length: 591 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
CAA52803 0 100.0 p85Mcm protein ...
 Homo sapiens
P33993 0 100.0 DNA replication...
 Homo sapiens
BAG37153 0 100.0 unnamed protein...
 Homo sapiens
BAG53399 0 99.8 unnamed protein...
 Homo sapiens
BAA09534 0 99.8 P1cdc47 [Homo s...
 Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR001208 190 225 PD001041 MCM
FPrintScan IPR008050 36 47 PR01663 MCM protein 7
IPR008050 54 65 PR01663 MCM protein 7
IPR008050 71 83 PR01663 MCM protein 7
IPR008050 163 173 PR01663 MCM protein 7
IPR001208 244 259 PR01657 MCM
IPR001208 304 318 PR01657 MCM
IPR001208 332 345 PR01657 MCM
IPR001208 356 368 PR01657 MCM
IPR001208 383 391 PR01657 MCM
HMMPfam IPR001208 192 514 PF00493 MCM
HMMSmart IPR001208 17 514 SM00350 MCM
IPR003593 245 398 SM00382 AAA+ ATPase
ProfileScan IPR001208 204 409 PS50051 MCM
ScanRegExp IPR001208 312 320 PS00847 MCM
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp