ORK06010

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06010

Order Kazusa clone(s) from :

Accession No	AB209420
Product ID	ORK06010
Clone name	pg00680
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	MLLT4
cDNA sequence	DNA sequence (6635 bp) Predicted protein sequence (1639 aa)
Description	Afadin (Protein AF-6).

Features of the cloned cDNA sequence

Description

Length: 6635 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1714 bp
Genome contig ID	gi89161210f_167870697
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ATTTGTTGGGTAGAATAAAGTTGTCTTGTAATTGT
Flanking genome sequence (237130 - 237179)	----+--------+--------+--------+--------+----* ATCTGCTCTTGGTATAACTAAAAGAGGATATTTTGATTTCTTCCTAAAAT

Features of the protein sequence

Description

Length: 1639 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92657	100.0	Afadin variant ...	Homo sapiens
NP_001035089	100.0	myeloid/lymphoi...	Homo sapiens
CAI20900	99.8	myeloid/lymphoi...	Homo sapiens
XP_001082272	99.2	similar to Afad...	Macaca mulatta
XP_001083271	99.0	similar to Afad...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002710	773	851	PD003376	Dilute
HMMPfam	IPR000159	27	121	PF00788	Ras-association
	IPR000159	234	336	PF00788	Ras-association
	IPR000253	414	480	PF00498	Forkhead-associated
	IPR002710	773	879	PF01843	Dilute
	IPR001478	997	1078	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR000159	27	121	SM00314	Ras-association
	IPR000159	234	336	SM00314	Ras-association
	IPR000253	413	465	SM00240	Forkhead-associated
	IPR001478	1004	1081	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR000159	27	121	PS50200	Ras-association
	IPR000159	234	336	PS50200	Ras-association
	IPR002710	656	896	PS51126	Dilute
	IPR001478	995	1081	PS50106	PDZ/DHR/GLGF

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp