Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06047
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209348
Product ID ORK06047
Clone name fh13524
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol MTA1
cDNA sequence DNA sequence (1559 bp)
Predicted protein sequence (511 aa)
Description Metastasis-associated protein MTA1.
Features of the cloned cDNA sequence

Length: 1559 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 23 bp
Genome contig ID gi51511730f_104897739
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ATCGAGGACTAGGGGCCGCCCCCACCTGCGGCCGC
Flanking genome sequence
(109883 - 109932)
----+----*----+----*----+----*----+----*----+----*
CCCCCGCCCCTCGCCCGCCCACACGGCCCCTTCCCAGCCAGCCCGCCGCC

Features of the protein sequence

Length: 511 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92585 2e-202 100.0 metastasis asso...
Homo sapiens
EAW81920 1.1e-199 99.2 metastasis asso...
Homo sapiens
NP_004680 2.4e-199 99.0 metastasis-asso...
Homo sapiens
AAI42942 7.2e-199 99.0 Metastasis asso...
Homo sapiens
Q13330 7.8e-198 98.4 Metastasis-asso...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR014778 77 123 PF00249 Myb
IPR000679 185 222 PF00320 Zinc finger
HMMSmart IPR001005 76 125 SM00717 SANT
IPR000679 179 233 SM00401 Zinc finger
ProfileScan IPR000949 1 68 PS51156 ELM2
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp