ORK06114

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06114

Order Kazusa clone(s) from :

Accession No	AB209647
Product ID	ORK06114
Clone name	sh06345
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NCF2
cDNA sequence	DNA sequence (5684 bp) Predicted protein sequence (343 aa)
Description	Neutrophil cytosol factor 2 (NCF-2) (Neutrophil NADPH oxidase factor 2) (67 kDa neutrophil oxidase factor) (p67-phox) (NOXA2).

Features of the cloned cDNA sequence

Description

Length: 5684 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	558 bp
Genome contig ID	gi89161185r_181691321
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- GCATATACAAATAAACTTGTTTGTTTTCTTTTTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTATGTCTTGTTGCTTAAACAGAACCTAGACTGAGTTAGGTTCTCATGG

Features of the protein sequence

Description

Length: 343 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92884	5.8e-127	100.0	neutrophil cyto...	Homo sapiens
BAG60869	5.2e-105	100.0	unnamed protein...	Homo sapiens
P19878	5.6e-105	100.0	Neutrophil cyto...	Homo sapiens
AAM89263	5.6e-105	100.0	p67phox-like pr...	Homo sapiens
AAA36379	9.5e-105	99.6	neutrophil oxid...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001452	63	112	PD000066	Src homology-3
BlastProDom	IPR001452	278	329	PD000066	Src homology-3
FPrintScan	IPR000108	75	94	PR00499	Neutrophil cytosol factor 2
	IPR000108	101	120	PR00499	Neutrophil cytosol factor 2
	IPR001452	277	287	PR00452	Src homology-3
	IPR000108	279	299	PR00499	Neutrophil cytosol factor 2
	IPR001452	291	306	PR00452	Src homology-3
	IPR000108	299	315	PR00499	Neutrophil cytosol factor 2
	IPR000108	315	328	PR00499	Neutrophil cytosol factor 2
	IPR001452	319	331	PR00452	Src homology-3
HMMPfam	IPR001452	60	114	PF00018	Src homology-3
	IPR000270	168	246	PF00564	Octicosapeptide/Phox/Bem1p
	IPR001452	277	331	PF00018	Src homology-3
HMMSmart	IPR001452	60	115	SM00326	Src homology-3
	IPR000270	168	246	SM00666	Octicosapeptide/Phox/Bem1p
	IPR001452	277	332	SM00326	Src homology-3
ProfileScan	IPR001452	57	116	PS50002	Src homology-3
ProfileScan	IPR001452	274	333	PS50002	Src homology-3

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp