Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06125
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209440
Product ID ORK06125
Clone name pj01663
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NDUFA10
cDNA sequence DNA sequence (4636 bp)
Predicted protein sequence (241 aa)
Description NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 10, mitochondrial precursor (EC 1.6.5.3) (EC 1.6.99.3) (NADH-ubiquinone oxidoreductase 42 kDa subunit) (Complex I-42kD) (CI-42kD).
Features of the cloned cDNA sequence

Length: 4636 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3903 bp
Genome contig ID gi89161199r_240448831
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CTTCTGACTTCCAGAAATAAAAGTGTTTCCATGGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTCCCCATCGTACGTCTATGTGCGTGCGGGCACGTCGAAACTGCACA

Features of the protein sequence

Length: 241 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92677 1.2e-103 100.0 NADH dehydrogen...
Homo sapiens
AAY14737 5.3e-96 97.8 unknown [Homo s...
Homo sapiens
O95299 5.6e-96 97.8 NADH dehydrogen...
Homo sapiens
AAQ02478 5.6e-96 97.8 NADH dehydrogen...
synthetic construct
Q0MQB7 1.5e-95 96.9 NADH dehydrogen...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002624 136 228 PF01712 Deoxynucleoside kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp