Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06133
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209852
Product ID ORK06133
Clone name ef01465
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NET1
cDNA sequence DNA sequence (2522 bp)
Predicted protein sequence (435 aa)
Description Neuroepithelial cell-transforming gene 1 protein (p65 Net1 proto- oncogene) (Rho guanine nucleotide exchange factor 8).
Features of the cloned cDNA sequence

Length: 2522 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1213 bp
Genome contig ID gi89161187f_5344568
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTTATTGTAAAGTAGTTTTTAGCATTTGCTTTAC
Flanking genome sequence
(145032 - 145081)
----+----*----+----*----+----*----+----*----+----*
TATTTTTTTACTTTGATGCCTTTTCAAATTGGCATGTCTTTAAAGTATTT

Features of the protein sequence

Length: 435 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93089 4.8e-166 100.0 neuroepithelial...
Homo sapiens
Q7Z628 3.2e-153 100.0 Neuroepithelial...
Homo sapiens
XP_507633 7.4e-153 99.7 neuroepithelial...
Pan troglodytes
AAC71772 1.2e-139 91.6 NET1 homolog [M...
Mus musculus
Q9Z206 1.2e-139 91.6 Neuroepithelial...
Mus musculus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000219 207 384 PF00621 DH
HMMSmart IPR000219 207 384 SM00325 DH
ProfileScan IPR000219 203 385 PS50010 DH
ScanRegExp IPR001331 333 358 PS00741 Guanine-nucleotide dissociation stimulator
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp