Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06143
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208786
Product ID ORK06143
Clone name ha06676
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol NFE2L2
cDNA sequence DNA sequence (2358 bp)
Predicted protein sequence (600 aa)
Description Nuclear factor erythroid 2-related factor 2 (NF-E2-related factor 2) (NFE2-related factor 2) (Nuclear factor, erythroid derived 2, like 2) (HEBP1).
Features of the cloned cDNA sequence

Length: 2358 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 474 bp
Genome contig ID gi89161199r_177703285
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AGAGCTGGTACTAATAAAGGATTATTATGACTGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATTATTTGTTTGGGATTCCTTTGAGTTTATTCACACAGTATTTTCCAT

Features of the protein sequence

Length: 600 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92023 7.6e-213 100.0 nuclear factor ...
Homo sapiens
Q16236 1.8e-209 99.8 Nuclear factor ...
Homo sapiens
EAX11061 5.7e-209 100.0 nuclear factor ...
Homo sapiens
ACE87835 1.1e-208 99.8 nuclear factor ...
synthetic construct
I59340 2.4e-208 99.6 transcription f...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR011616 491 554 PF00170 bZIP transcription factor
HMMSmart IPR004827 490 554 SM00338 Basic-leucine zipper (bZIP) transcription factor
ProfileScan IPR004827 492 555 PS50217 Basic-leucine zipper (bZIP) transcription factor
ScanRegExp IPR004827 497 512 PS00036 Basic-leucine zipper (bZIP) transcription factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp