ORK06143

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06143

Order Kazusa clone(s) from :

Accession No	AB208786
Product ID	ORK06143
Clone name	ha06676
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
Symbol	NFE2L2
cDNA sequence	DNA sequence (2358 bp) Predicted protein sequence (600 aa)
Description	Nuclear factor erythroid 2-related factor 2 (NF-E2-related factor 2) (NFE2-related factor 2) (Nuclear factor, erythroid derived 2, like 2) (HEBP1).

Features of the cloned cDNA sequence

Description

Length: 2358 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	474 bp
Genome contig ID	gi89161199r_177703285
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGAGCTGGTACTAATAAAGGATTATTATGACTGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATTATTTGTTTGGGATTCCTTTGAGTTTATTCACACAGTATTTTCCAT

Features of the protein sequence

Description

Length: 600 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92023	7.6e-213	100.0	nuclear factor ...	Homo sapiens
Q16236	1.8e-209	99.8	Nuclear factor ...	Homo sapiens
EAX11061	5.7e-209	100.0	nuclear factor ...	Homo sapiens
ACE87835	1.1e-208	99.8	nuclear factor ...	synthetic construct
I59340	2.4e-208	99.6	transcription f...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011616	491	554	PF00170	bZIP transcription factor
HMMSmart	IPR004827	490	554	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR004827	492	555	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR004827	497	512	PS00036	Basic-leucine zipper (bZIP) transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp