ORK06160

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06160

Order Kazusa clone(s) from :

Accession No	AB209111
Product ID	ORK06160
Clone name	hh09010
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	NLE1
cDNA sequence	DNA sequence (5249 bp) Predicted protein sequence (487 aa)
Description	Notchless protein homolog 1.

Features of the cloned cDNA sequence

Description

Length: 5249 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3680 bp
Genome contig ID	gi51511734r_30380308
PolyA signal sequence (AATAAA,-9)	+--------+--------+----*----+---- GTAATAATAATAGAAATAAAGTACACAATAAATGT
Flanking genome sequence (99577 - 99528)	----+--------+--------+--------+--------+----* AATATGCTTGACTCATCCTGAAACCATCCCCCCAACCGGATCCATGGAAA

Features of the protein sequence

Description

Length: 487 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92348	6.4e-208	100.0	Notchless gene ...	Homo sapiens
EAW80167	5.3e-207	99.5	notchless homol...	Homo sapiens
AAH02884	1.8e-203	99.7	NLE1 protein [H...	Homo sapiens
Q9NVX2	1.8e-203	99.7	Notchless prote...	Homo sapiens
EAW80166	2.8e-203	99.5	notchless homol...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	111	145	PD000018	WD40 repeat
	IPR001680	153	186	PD000018	WD40 repeat
	IPR001680	196	235	PD000018	WD40 repeat
	IPR001680	244	274	PD000018	WD40 repeat
	IPR001680	370	402	PD000018	WD40 repeat
	IPR001680	411	445	PD000018	WD40 repeat
	IPR001680	454	485	PD000018	WD40 repeat
FPrintScan	IPR001680	131	145	PR00320	WD40 repeat
	IPR001680	221	235	PR00320	WD40 repeat
	IPR001632	412	428	PR00319	G-protein
	IPR001632	431	445	PR00319	G-protein
	IPR001680	431	445	PR00320	WD40 repeat
	IPR001632	468	485	PR00319	G-protein
HMMPfam	IPR012972	18	79	PF08154	NLE
	IPR001680	106	144	PF00400	WD40 repeat
	IPR001680	148	186	PF00400	WD40 repeat
	IPR001680	191	234	PF00400	WD40 repeat
	IPR001680	238	275	PF00400	WD40 repeat
	IPR001680	279	359	PF00400	WD40 repeat
	IPR001680	364	402	PF00400	WD40 repeat
	IPR001680	406	444	PF00400	WD40 repeat
	IPR001680	448	486	PF00400	WD40 repeat
HMMSmart	IPR001680	105	144	SM00320	WD40 repeat
	IPR001680	147	186	SM00320	WD40 repeat
	IPR001680	190	234	SM00320	WD40 repeat
	IPR001680	237	275	SM00320	WD40 repeat
	IPR001680	278	359	SM00320	WD40 repeat
	IPR001680	363	402	SM00320	WD40 repeat
	IPR001680	405	444	SM00320	WD40 repeat
	IPR001680	447	486	SM00320	WD40 repeat
ProfileScan	IPR001680	112	153	PS50082	WD40 repeat
	IPR001680	112	487	PS50294	WD40 repeat
	IPR001680	154	195	PS50082	WD40 repeat
	IPR001680	197	243	PS50082	WD40 repeat
	IPR001680	244	274	PS50082	WD40 repeat
	IPR001680	370	411	PS50082	WD40 repeat
	IPR001680	412	453	PS50082	WD40 repeat
	IPR001680	454	487	PS50082	WD40 repeat
ScanRegExp	IPR001680	131	145	PS00678	WD40 repeat
	IPR001680	221	235	PS00678	WD40 repeat
	IPR001680	389	403	PS00678	WD40 repeat
	IPR001680	431	445	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp