Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06215
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209915
Product ID ORK06215
Clone name ej00652
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol NXF1
cDNA sequence DNA sequence (4077 bp)
Predicted protein sequence (369 aa)
Description Nuclear RNA export factor 1 (Tip-associating protein) (Tip-associated protein) (mRNA export factor TAP).
Features of the cloned cDNA sequence

Length: 4077 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 2935 bp
Genome contig ID gi51511727r_62216165
PolyA signal sequence
(TATAAA,-18)
+----*----+----*----+----*----+----
TGTTCTGCACTTTTTAATATAAAGAGTGATGTTGT
Flanking genome sequence
(100014 - 99965)
----+----*----+----*----+----*----+----*----+----*
ATTTCGTGTTCTGCGTGCTGGATTGGTTGTCTCCTCCCAGCCCTGAGCGA

Features of the protein sequence

Length: 369 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93152 1.1e-147 100.0 nuclear RNA exp...
Homo sapiens
EAW74105 1.6e-141 100.0 nuclear RNA exp...
Homo sapiens
Q5R752 1.5e-134 96.6 Nuclear RNA exp...
Pongo abelii
XP_001115982 4.1e-134 100.0 similar to nucl...
Macaca mulatta
XP_001157780 2.3e-133 99.1 nuclear RNA exp...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001611 280 293 PR00019 Leucine-rich repeat
IPR001611 303 316 PR00019 Leucine-rich repeat
HMMPfam IPR015245 126 213 PF09162 Tap
IPR001611 305 328 PF00560 Leucine-rich repeat
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp