Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06249
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208783
Product ID ORK06249
Clone name fj13336
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol OVGP1
cDNA sequence DNA sequence (2618 bp)
Predicted protein sequence (742 aa)
Description Oviduct-specific glycoprotein precursor (Oviductal glycoprotein) (Oviductin) (Estrogen-dependent oviduct protein) (Mucin-9).
Features of the cloned cDNA sequence

Length: 2618 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 143 bp
Genome contig ID gi89161185r_111658466
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
AATCTCTTTTCCATTAAATAAACTGTAAACACAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACCCACCGAGTTCTCTGAGATTCTTTTCTTGAATTGAACTCTGCAACTC

Features of the protein sequence

Length: 742 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92020 0 100.0 Oviduct-specifi...
Homo sapiens
Q12889 0 96.6 Oviduct-specifi...
Homo sapiens
EAW56492 0 96.4 oviductal glyco...
Homo sapiens
AAB04126 0 96.0 oviductal glyco...
Homo sapiens
AAO37816 0 96.0 oviductin [Homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR015821 65 105 PD000471 Glycoside hydrolase
HMMPfam IPR001223 64 424 PF00704 Glycoside hydrolase
HMMSmart IPR011583 64 424 SM00636 Chitinase II
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp