Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06269
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209304
Product ID ORK06269
Clone name fg00659
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PAPOLG
cDNA sequence DNA sequence (6084 bp)
Predicted protein sequence (382 aa)
Description Poly(A) polymerase gamma (EC 2.7.7.19) (PAP gamma) (Polynucleotide adenylyltransferase gamma) (SRP RNA 3' adenylating enzyme) (Neo- poly(A) polymerase) (Neo-PAP).
Features of the cloned cDNA sequence

Length: 6084 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4935 bp
Genome contig ID gi89161199f_60763323
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
GGAATAAGTAATCAAATAAAATTGCTTTGATAAAT
Flanking genome sequence
(119403 - 119452)
----+----*----+----*----+----*----+----*----+----*
AGGTGATGATTGAGTGATGTTATTTGGGACTAACTCAAAAGTACCAGAAG

Features of the protein sequence

Length: 382 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92541 1.5e-139 100.0 poly(A) polymer...
Homo sapiens
XP_001158896 2.4e-139 100.0 poly(A) polymer...
Pan troglodytes
XP_515496 2.5e-139 100.0 poly(A) polymer...
Pan troglodytes
XP_865689 8.4e-127 91.4 similar to poly...
Canis lupus fam...
EAX00031 8.2e-121 94.5 poly(A) polymer...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007012 1 32 PF04928 Poly(A) polymerase
IPR007010 33 175 PF04926 Poly(A) polymerase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp