Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06301
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226121
Product ID ORK06301
Clone name hh13530
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PCYT1B
cDNA sequence DNA sequence (5495 bp)
Predicted protein sequence (363 aa)
Description Choline-phosphate cytidylyltransferase B (EC 2.7.7.15) (Phosphorylcholine transferase B) (CTP:phosphocholine cytidylyltransferase B) (CT B) (CCT B) (CCT-beta).
Features of the cloned cDNA sequence

Length: 5495 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4209 bp
Genome contig ID gi89161218r_24386126
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TCAACTCGTTTATAAATAAAGGGATGCAGAATTGC
Flanking genome sequence
(314775 - 314726)
----+----*----+----*----+----*----+----*----+----*
ATATCACAATTTATATTCCTTTTGGTATATATCCAGTAATGGGACTGCTG

Features of the protein sequence

Length: 363 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAG59022 1.7e-128 99.7 unnamed protein...
Homo sapiens
AAH45634 3.8e-128 99.7 PCYT1B protein ...
Homo sapiens
XP_859908 7.3e-124 95.7 similar to Chol...
Canis lupus fam...
XP_520980 1.8e-122 95.4 phosphate cytid...
Pan troglodytes
Q9Y5K3 2.5e-120 97.6 Choline-phospha...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004820 74 202 PF01467 Cytidylyltransferase
HMMTigr IPR004821 72 139 TIGR00125 Cytidyltransferase-related
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp