ORK06317

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06317

Order Kazusa clone(s) from :

Accession No	AB209835
Product ID	ORK06317
Clone name	bm05545
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PDPK1
cDNA sequence	DNA sequence (1729 bp) Predicted protein sequence (492 aa)
Description	3-phosphoinositide-dependent protein kinase 1 (EC 2.7.11.1) (hPDK1).

Features of the cloned cDNA sequence

Description

Length: 1729 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	248 bp
Genome contig ID	gi51511732f_2427999
PolyA signal sequence (None)	+--------+--------+----*----+---- AAACCTTGCAGCATTTTTATTTAGAAAAAAAGAAG
Flanking genome sequence (159925 - 159974)	----+--------+--------+--------+--------+----* AAAAAAAACACCCAACCACACAAAGAACAAAACCAGTAACAAACACAAAG

Features of the protein sequence

Description

Length: 492 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93072	8.7e-176	100.0	3-phosphoinosit...	Homo sapiens
O15530	1.4e-157	100.0	3-phosphoinosit...	Homo sapiens
AAX29847	1.4e-157	100.0	3-phosphoinosit...	synthetic construct
BAD96301	1.4e-156	99.3	3-phosphoinosit...	Homo sapiens
EDM03805	2.8e-148	94.6	3-phosphoinosit...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	120	380	PD000001	Protein kinase
HMMPfam	IPR000719	120	380	PF00069	Protein kinase
HMMSmart	IPR001245	120	380	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	120	380	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	120	380	PS50011	Protein kinase
ScanRegExp	IPR000169	3	14	PS00139	Peptidase
	IPR000719	126	149	PS00107	Protein kinase
	IPR008271	239	251	PS00108	Serine/threonine protein kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp