Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06334
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB208906
Product ID ORK06334
Clone name pj00928
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PEX6
cDNA sequence DNA sequence (3956 bp)
Predicted protein sequence (836 aa)
Description Peroxisome assembly factor 2 (PAF-2) (Peroxisomal-type ATPase 1) (Peroxin-6) (Peroxisomal biogenesis factor 6).
Features of the cloned cDNA sequence

Length: 3956 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1443 bp
Genome contig ID gi89161210r_42939725
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTCTGTGGCTGAAAATAAAGCATGTCCCGCCCCCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTGGTGTTGTGGCATGAAAGGTTGGAGTGAGAAAGAGCAGGGTTGTGGG

Features of the protein sequence

Length: 836 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92143 0 100.0 peroxisomal bio...
Homo sapiens
BAB83046 0 98.5 peroxine Pex6p ...
Homo sapiens
Q13608 0 98.5 Peroxisome asse...
Homo sapiens
AAC50655 0 98.4 Pxaaa1p [Homo s...
Homo sapiens
XP_001089644 0 96.0 peroxisomal bio...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003959 482 665 PF00004 AAA ATPase
IPR003959 756 800 PF00004 AAA ATPase
HMMSmart IPR003593 479 614 SM00382 AAA+ ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp