ORK06362

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06362

Order Kazusa clone(s) from :

Accession No	AB208835
Product ID	ORK06362
Clone name	aj00209
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3CD
cDNA sequence	DNA sequence (4411 bp) Predicted protein sequence (845 aa)
Description	Phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta isoform (EC 2.7.1.153) (PI3-kinase p110 subunit delta) (PtdIns-3- kinase p110) (PI3K) (p110delta).

Features of the cloned cDNA sequence

Description

Length: 4411 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1873 bp
Genome contig ID	gi89161185f_9599083
PolyA signal sequence (AGTAAA,-23)	+--------+--------+----*----+---- CTTGAAATGAGAAGTAAAGGCAGATGAAAAGAAAG
Flanking genome sequence (112484 - 112533)	----+--------+--------+--------+--------+----* AAAAAGCCTTTTTATGTTCTTTTATGTTCTCGGCTCAAAAAGAAACAAGG

Features of the protein sequence

Description

Length: 845 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92072	100.0	phosphoinositid...	Homo sapiens
O00329	99.7	Phosphatidylino...	Homo sapiens
AAC25677	99.6	phosphatidylino...	Homo sapiens
AAI50298	99.6	Phosphoinositid...	Homo sapiens
BAG36870	99.6	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000341	1	82	PF00794	Phosphoinositide 3-kinase
	IPR002420	138	272	PF00792	Phosphoinositide 3-kinase
	IPR001263	300	485	PF00613	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	574	792	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR000341	1	82	SM00144	Phosphoinositide 3-kinase
	IPR002420	110	213	SM00142	Phosphoinositide 3-kinase
	IPR001263	299	486	SM00145	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	576	842	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR000403	575	825	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	579	593	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	679	699	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp