Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06380
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209150
Product ID ORK06380
Clone name ag00037
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PLA2G4B
cDNA sequence DNA sequence (7217 bp)
Predicted protein sequence (586 aa)
Description Cytosolic phospholipase A2 beta (EC 3.1.1.4) (cPLA2-beta) (Phospholipase A2 group IVB).
Features of the cloned cDNA sequence

Length: 7217 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 295 bp
Genome contig ID gi51511731f_39807585
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GATACATCACAGACTCATACAAATGTGAGGCGCTG
Flanking genome sequence
(120062 - 120111)
----+----*----+----*----+----*----+----*----+----*
AGACCATCTGTTATTACTGCTGAGAAGGGCCATGTCATTCTAGGCTCTTG

Features of the protein sequence

Length: 586 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92387 0 100.0 phospholipase A...
Homo sapiens
EAW92522 0 100.0 phospholipase A...
Homo sapiens
NP_001108105 0 100.0 cytosolic phosp...
Homo sapiens
AAD32135 0 100.0 cytosolic phosp...
Homo sapiens
O95712 0 100.0 Cytosolic phosp...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR002642 102 531 PF01735 Lysophospholipase
HMMSmart IPR002642 26 533 SM00022 Lysophospholipase
ProfileScan IPR002642 51 586 PS51210 Lysophospholipase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp