Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06395
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209716
Product ID ORK06395
Clone name bm01173
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol PLEKHB1
cDNA sequence DNA sequence (1920 bp)
Predicted protein sequence (212 aa)
Description Pleckstrin homology domain-containing family B member 1 (Pleckstrin homology domain retinal protein 1) (PH domain-containing protein in retina 1) (PHRET1).
Features of the cloned cDNA sequence

Length: 1920 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1209 bp
Genome contig ID gi51511727f_72936330
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTGCTGCCGAGACTAATAAAGATTTGGTTGGCTCT
Flanking genome sequence
(115176 - 115225)
----+----*----+----*----+----*----+----*----+----*
AGCAGTAACTGTGGCTTGCTTTGTTCCCCCAGAAGGCCCTGTTTCCCTCT

Features of the protein sequence

Length: 212 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92953 1.3e-94 100.0 pleckstrin homo...
Homo sapiens
BAE87223 7.6e-93 97.6 unnamed protein...
Macaca fascicularis
AAF18572 7.1e-91 100.0 PHR1 isoform 2 ...
Homo sapiens
XP_001174841 9.1e-90 99.0 pleckstrin homo...
Pan troglodytes
XP_001115425 1.7e-89 98.0 similar to plec...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001849 26 132 PF00169 Pleckstrin-like
HMMSmart IPR001849 26 134 SM00233 Pleckstrin-like
ProfileScan IPR001849 25 132 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp