Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06423
Order Kazusa clone(s) from : Japan || Other countries
Accession No AK226057
Product ID ORK06423
Clone name ph00591
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol POLI
cDNA sequence DNA sequence (5617 bp)
Predicted protein sequence (615 aa)
Description DNA polymerase iota (EC 2.7.7.7) (RAD30 homolog B) (Eta2).
Features of the cloned cDNA sequence

Length: 5617 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3767 bp
Genome contig ID gi51511735f_49958069
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
TAACTGTCCAAGTCAAGAAATAAAACATATCAAGT
Flanking genome sequence
(120533 - 120582)
----+----*----+----*----+----*----+----*----+----*
AATCAAGAAGTCCAGAGTTTTCTTTGGGGTTTCATTACGTAGGCATGATT

Features of the protein sequence

Length: 615 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAH32662 0 100.0 Polymerase (DNA...
Homo sapiens
NP_009126 0 100.0 DNA polymerase ...
Homo sapiens
AAI42675 0 99.8 POLI protein [H...
Homo sapiens
Q9UNA4 0 99.8 DNA polymerase ...
Homo sapiens
EAW63000 0 99.8 polymerase (DNA...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001126 1 315 PF00817 UMUC-like DNA-repair protein
ProfileScan IPR001126 1 143 PS50173 UMUC-like DNA-repair protein
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp