Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06474
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209162
Product ID ORK06474
Clone name ah00223
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PRDM15
cDNA sequence DNA sequence (5189 bp)
Predicted protein sequence (186 aa)
Description PR domain zinc finger protein 15 (PR domain-containing protein 15) (Zinc finger protein 298).
Features of the cloned cDNA sequence

Length: 5189 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi51511750r_41994863
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTAACCAACATCACCGTGACCCCCATCACCACTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
GGCCGCGACTCAGTTTACCAATCTCCAGCCGGTGGCCGTGGGGCACCTTA

Features of the protein sequence

Length: 186 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92399 5.4e-68 100.0 PR domain conta...
Homo sapiens
AAL60596 2.1e-67 100.0 C21orf83 isofor...
Homo sapiens
BAD99018 3.4e-67 100.0 zinc finger pro...
Homo sapiens
XP_001118643 3.6e-67 100.0 PR domain conta...
Macaca mulatta
EAX09586 4.2e-67 100.0 PR domain conta...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR007087 6 29 PF00096 Zinc finger
IPR007087 35 58 PF00096 Zinc finger
HMMSmart IPR015880 6 29 SM00355 Zinc finger
IPR015880 35 58 SM00355 Zinc finger
ProfileScan IPR007087 6 34 PS50157 Zinc finger
ScanRegExp IPR007087 8 29 PS00028 Zinc finger
IPR007087 37 58 PS00028 Zinc finger
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp