ORK06476

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06476

Order Kazusa clone(s) from :

Accession No
Product ID	ORK06476
Clone name	bm04789
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PREB
cDNA sequence	DNA sequence (2103 bp) Predicted protein sequence (469 aa)
HaloTag ORF Clone	FHC06476
Flexi ORF Clone	FXC06476
Description	Prolactin regulatory element-binding protein (Mammalian guanine nucleotide exchange factor mSec12).

Features of the cloned cDNA sequence

Description

Length: 2103 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	655 bp
Genome contig ID	gi89161199r_27107131
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ATTTAATAAACAAGGAAAGAGTGAACTGAGACCCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATGGTACTCTTGTCAGCTGTTTCTGTCCTCAGAAGGTAAGAGAGCCCT

Features of the protein sequence

Description

Length: 469 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9HCU5	6.7e-163	100.0	Prolactin regul...	Homo sapiens
AAG01692	1.2e-162	99.7	prolactin regul...	Homo sapiens
BAF84867	1.8e-162	99.7	unnamed protein...	Homo sapiens
XP_515352	1.3e-153	98.7	prolactin regul...	Pan troglodytes
XP_001088763	9.2e-152	97.9	prolactin regul...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	212	234	PF00400	WD40 repeat
HMMPfam	IPR001680	238	275	PF00400	WD40 repeat
HMMSmart	IPR001680	195	234	SM00320	WD40 repeat
	IPR001680	237	275	SM00320	WD40 repeat
	IPR001680	341	380	SM00320	WD40 repeat
	IPR001680	383	434	SM00320	WD40 repeat
ProfileScan	IPR001680	212	243	PS50082	WD40 repeat
ProfileScan	IPR001680	212	284	PS50294	WD40 repeat

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	366	FLGLGTVTGSVAIYIAFSLQCLY	388	PRIMARY	23
SOSUI2	2	444	WLLLLLCVGLIIVTILLLQSAFP	466	PRIMARY	23