Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06478
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209189
Product ID ORK06478
Clone name fj02009
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PRKACB
cDNA sequence DNA sequence (4563 bp)
Predicted protein sequence (365 aa)
Description cAMP-dependent protein kinase, beta-catalytic subunit (EC 2.7.11.11) (PKA C-beta).
Features of the cloned cDNA sequence

Length: 4563 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3222 bp
Genome contig ID gi89161185f_84302975
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TCAATAACTGCAAAATTAAAGTACCTTCAATGGAT
Flanking genome sequence
(173789 - 173838)
----+----*----+----*----+----*----+----*----+----*
AAGACAATTGATTGAGTCGTGAATTCTACTTGGTGCCCTCATCTCCTGAT

Features of the protein sequence

Length: 365 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92426 1.4e-147 100.0 cAMP-dependent ...
Homo sapiens
XP_001137073 2.9e-132 100.0 cAMP-dependent ...
Pan troglodytes
XP_001105953 5.2e-132 99.6 cAMP-dependent ...
Macaca mulatta
XP_001136609 3.1e-131 99.6 cAMP-dependent ...
Pan troglodytes
XP_867552 1e-130 98.4 similar to cAMP...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR000719 70 324 PD000001 Protein kinase
HMMPfam IPR000719 70 324 PF00069 Protein kinase
HMMSmart IPR001245 70 315 SM00219 Tyrosine protein kinase
IPR002290 70 324 SM00220 Serine/threonine protein kinase
ProfileScan IPR000719 70 324 PS50011 Protein kinase
ScanRegExp IPR000719 76 99 PS00107 Protein kinase
IPR008271 189 201 PS00108 Serine/threonine protein kinase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp