ORK06487

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06487

Order Kazusa clone(s) from :

Accession No	AB209475
Product ID	ORK06487
Clone name	ah05266
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PRKCA
cDNA sequence	DNA sequence (6007 bp) Predicted protein sequence (461 aa)
Description	Protein kinase C alpha type (EC 2.7.11.13) (PKC-alpha) (PKC-A).

Features of the cloned cDNA sequence

Description

Length: 6007 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	4301 bp
Genome contig ID	gi51511734f_61629440
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTGCAGCCTGGGCGACAGAGCGAGACTCCATCTC
Flanking genome sequence (575657 - 575706)	----+--------+--------+--------+--------+----* AAAAAAATAAAAGAAAAAAAGAAAACGGTGATATTCTTTAAAGATGACAC

Features of the protein sequence

Description

Length: 461 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92712	1.5e-184	100.0	protein kinase ...	Homo sapiens
P17252	8.7e-174	97.9	Protein kinase ...	Homo sapiens
AAX36750	8.7e-174	97.9	protein kinase ...	synthetic construct
XP_001494639	1.2e-173	97.7	similar to Prot...	Equus caballus
EDM06446	1.7e-173	97.7	protein kinase ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	250	449	PD000001	Protein kinase
FPrintScan	IPR002219	10	24	PR00008	Protein kinase C
	IPR002219	26	35	PR00008	Protein kinase C
	IPR002219	39	50	PR00008	Protein kinase C
	IPR002219	51	63	PR00008	Protein kinase C
	IPR000008	99	111	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	128	141	PR00360	C2 calcium-dependent membrane targeting
	IPR000008	151	159	PR00360	C2 calcium-dependent membrane targeting
HMMPfam	IPR002219	13	65	PF00130	Protein kinase C
	IPR000008	84	171	PF00168	C2 calcium-dependent membrane targeting
	IPR000719	250	450	PF00069	Protein kinase
HMMSmart	IPR002219	13	62	SM00109	Protein kinase C
	IPR000008	83	186	SM00239	C2 calcium-dependent membrane targeting
	IPR001245	250	461	SM00219	Tyrosine protein kinase
	IPR002290	250	456	SM00220	Serine/threonine protein kinase
ProfileScan	IPR002219	12	62	PS50081	Protein kinase C
	IPR000008	83	171	PS50004	C2 calcium-dependent membrane targeting
	IPR000719	250	461	PS50011	Protein kinase
ScanRegExp	IPR002219	13	62	PS00479	Protein kinase C
	IPR000719	256	279	PS00107	Protein kinase
	IPR008271	370	382	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	435	YGVLLYEMLAGQVMFCYIFMFVY	457	PRIMARY	23