ORK06490

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06490

Order Kazusa clone(s) from :

Accession No	AB208860
Product ID	ORK06490
Clone name	fk01269
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PRKDC
cDNA sequence	DNA sequence (3240 bp) Predicted protein sequence (726 aa)
Description	DNA-dependent protein kinase catalytic subunit (EC 2.7.11.1) (DNA-PK catalytic subunit) (DNA-PKcs) (DNPK1) (p460).

Features of the cloned cDNA sequence

Description

Length: 3240 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1058 bp
Genome contig ID	gi51511724r_48748238
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AGTATACTCTTGAGTGTTTAATAAAGTTTTTTTCC
Flanking genome sequence (99991 - 99942)	----+--------+--------+--------+--------+----* AAAAGTAGTGTGTATCTCTTTTATGCAGTTTCAAGAGCAAAATATTCATC

Features of the protein sequence

Description

Length: 726 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92097	100.0	protein kinase,...	Homo sapiens
EAW86680	100.0	protein kinase,...	Homo sapiens
AAC50210	100.0	DNA dependent p...	Homo sapiens
XP_001129414	99.8	similar to prot...	Homo sapiens
XP_519750	99.7	protein kinase,...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000403	376	613	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMPfam	IPR003152	694	726	PF02260	PIK-related kinase
HMMSmart	IPR000403	378	666	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR014009	1	168	PS51189	PIK-related kinase
	IPR000403	377	726	PS50290	Phosphatidylinositol 3- and 4-kinase
	IPR003152	694	726	PS51190	PIK-related kinase
ScanRegExp	IPR000403	381	395	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	505	525	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp