Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06503
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209573
Product ID ORK06503
Clone name sj00374
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CYTH2
cDNA sequence DNA sequence (4623 bp)
Predicted protein sequence (247 aa)
Description Cytohesin-2 (PH, SEC7 and coiled-coil domain-containing protein 2) (ARF nucleotide-binding site opener) (Protein ARNO) (ARF exchange factor).
Features of the cloned cDNA sequence

Length: 4623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 3585 bp
Genome contig ID gi42406306f_53564416
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AACACGCTGTTGGTAATCTTATTAATTATTTAACC
Flanking genome sequence
(110037 - 110086)
----+----*----+----*----+----*----+----*----+----*
ACTTGGCCTGCTGACCCCCTCATTTCTTGGGGTTGACAGAGTCGAGGTGC

Features of the protein sequence

Length: 247 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92810 6.9e-110 100.0 pleckstrin homo...
Homo sapiens
XP_533630 1.1e-95 99.1 similar to Cyto...
Canis lupus fam...
Q2KI41 1.4e-94 94.8 Cytohesin-2; PH...
Bos taurus
AAH70928 7.4e-94 97.3 Pscd2 protein [...
Rattus norvegicus
EAW52351 3.1e-93 99.5 pleckstrin homo...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000904 4 189 PF01369 SEC7-like
HMMSmart IPR000904 4 189 SM00222 SEC7-like
ProfileScan IPR000904 3 187 PS50190 SEC7-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp