Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06510
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209589
Product ID ORK06510
Clone name sj05239
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol PSMA6
cDNA sequence DNA sequence (4736 bp)
Predicted protein sequence (80 aa)
Description Proteasome subunit alpha type 6 (EC 3.4.25.1) (Proteasome iota chain) (Macropain iota chain) (Multicatalytic endopeptidase complex iota chain) (27 kDa prosomal protein) (PROS-27) (p27K).
Features of the cloned cDNA sequence

Length: 4736 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 4377 bp
Genome contig ID gi51511730f_34751700
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
ACTCTATATAAATAAAAACAAGGCTTTTGGAAAAT
Flanking genome sequence
(104731 - 104780)
----+----*----+----*----+----*----+----*----+----*
AATTGCATCCTGTTGTTTTCACCTCCTATTTTAAAATTTATTTTTGACAC

Features of the protein sequence

Length: 80 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92826 2.1e-34 100.0 proteasome alph...
Homo sapiens
XP_001085854 5e-29 100.0 similar to Prot...
Macaca mulatta
XP_001139565 1.2e-28 97.2 proteasome alph...
Pan troglodytes
XP_001085957 5.2e-26 97.0 similar to Prot...
Macaca mulatta
XP_862190 2.8e-23 93.8 similar to Prot...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR001353 5 68 PF00227 20S proteasome
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp