ORK06524

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06524

Order Kazusa clone(s) from :

Accession No	AB209083
Product ID	ORK06524
Clone name	hk04772
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTK2
cDNA sequence	DNA sequence (4249 bp) Predicted protein sequence (1007 aa)
Description	Focal adhesion kinase 1 (EC 2.7.10.2) (FADK 1) (pp125FAK) (Protein- tyrosine kinase 2).

Features of the cloned cDNA sequence

Description

Length: 4249 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1061 bp
Genome contig ID	gi51511724r_141637686
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CAGTTACTTTGACCTATTAAAAAGGTGTTACCAGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGTTCTTGTTGTAATATCCTTTCTTTTGGTTCTGTTTCTTCAGATGGC

Features of the protein sequence

Description

Length: 1007 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92320	100.0	PTK2 protein ty...	Homo sapiens
XP_001145802	99.0	similar to Foca...	Pan troglodytes
XP_001146015	98.3	similar to Foca...	Pan troglodytes
XP_856259	96.8	similar to Foca...	Canis lupus fam...
XP_532339	96.4	similar to Foca...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	403	632	PD000001	Protein kinase
FPrintScan	IPR001245	451	464	PR00109	Tyrosine protein kinase
	IPR001245	488	506	PR00109	Tyrosine protein kinase
	IPR001245	536	546	PR00109	Tyrosine protein kinase
	IPR001245	555	577	PR00109	Tyrosine protein kinase
	IPR001245	599	621	PR00109	Tyrosine protein kinase
HMMPfam	IPR001245	374	628	PF07714	Tyrosine protein kinase
HMMPfam	IPR005189	869	1007	PF03623	Focal adhesion targeting region
HMMSmart	IPR000299	1	169	SM00295	Band 4.1
	IPR001245	374	628	SM00219	Tyrosine protein kinase
	IPR002290	374	632	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000299	1	266	PS50057	Band 4.1
ProfileScan	IPR000719	374	632	PS50011	Protein kinase
ScanRegExp	IPR000719	380	406	PS00107	Protein kinase
	IPR008266	494	506	PS00109	Tyrosine protein kinase
	IPR000299	496	526	PS00661	Band 4.1

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp