ORK06525

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06525

Order Kazusa clone(s) from :

Accession No	AB209350
Product ID	ORK06525
Clone name	fh13874
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTK7
cDNA sequence	DNA sequence (5282 bp) Predicted protein sequence (773 aa)
Description	Tyrosine-protein kinase-like 7 precursor (Colon carcinoma kinase 4) (CCK-4).

Features of the cloned cDNA sequence

Description

Length: 5282 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2960 bp
Genome contig ID	gi89161210f_43052085
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACACTCGCTGCTCTCAATAAATAAGCCTTTTTTAC
Flanking genome sequence (185346 - 185395)	----+--------+--------+--------+--------+----* AACCTGTTTCTGAGATTCATTCCCTGCTCTTGCTCGTGGAAGATGTTCCT

Features of the protein sequence

Description

Length: 773 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92587	100.0	PTK7 protein ty...	Homo sapiens
AAN04866	100.0	transmembrane r...	Homo sapiens
Q13308	100.0	Tyrosine-protei...	Homo sapiens
2206402A	100.0	receptor Tyr ki...	Homo sapiens
BAF85278	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013151	86	143	PF00047	Immunoglobulin
	IPR013151	183	242	PF00047	Immunoglobulin
	IPR013151	279	343	PF00047	Immunoglobulin
	IPR013151	376	433	PF00047	Immunoglobulin
	IPR013098	452	538	PF07679	Immunoglobulin I-set
	IPR013098	542	628	PF07679	Immunoglobulin I-set
	IPR013098	632	721	PF07679	Immunoglobulin I-set
HMMSmart	IPR003599	78	162	SM00409	Immunoglobulin subtype
	IPR003598	84	148	SM00408	Immunoglobulin subtype 2
	IPR003599	175	260	SM00409	Immunoglobulin subtype
	IPR003598	181	247	SM00408	Immunoglobulin subtype 2
	IPR003599	271	360	SM00409	Immunoglobulin subtype
	IPR003598	277	348	SM00408	Immunoglobulin subtype 2
	IPR003599	368	449	SM00409	Immunoglobulin subtype
	IPR003598	374	438	SM00408	Immunoglobulin subtype 2
	IPR003599	458	539	SM00409	Immunoglobulin subtype
	IPR003598	464	528	SM00408	Immunoglobulin subtype 2
	IPR003599	548	629	SM00409	Immunoglobulin subtype
	IPR003598	555	617	SM00408	Immunoglobulin subtype 2
	IPR003599	638	722	SM00409	Immunoglobulin subtype
	IPR003598	644	711	SM00408	Immunoglobulin subtype 2
ProfileScan	IPR007110	55	160	PS50835	Immunoglobulin-like
	IPR007110	168	258	PS50835	Immunoglobulin-like
	IPR007110	265	341	PS50835	Immunoglobulin-like
	IPR007110	349	447	PS50835	Immunoglobulin-like
	IPR007110	452	537	PS50835	Immunoglobulin-like
	IPR007110	546	615	PS50835	Immunoglobulin-like
	IPR007110	616	720	PS50835	Immunoglobulin-like

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp