ORK06534

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06534

Order Kazusa clone(s) from :

Accession No	AB209670
Product ID	ORK06534
Clone name	pf03445
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTPRK
cDNA sequence	DNA sequence (2515 bp) Predicted protein sequence (742 aa)
Description	Receptor-type tyrosine-protein phosphatase kappa precursor (EC 3.1.3.48) (Protein-tyrosine phosphatase kappa) (R-PTP-kappa).

Features of the cloned cDNA sequence

Description

Length: 2515 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	285 bp
Genome contig ID	gi89161210r_128262825
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- TTCGGTCATTAAAGTACTGTTTATTCTTCATAGGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATGTTCTTGTTCTTTTCTTCCTTCTTATGACAGAAAAAGAATTTAA

Features of the protein sequence

Description

Length: 742 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92907	100.0	protein tyrosin...	Homo sapiens
XP_001167621	93.9	protein tyrosin...	Pan troglodytes
EAW48089	95.6	protein tyrosin...	Homo sapiens
CAI23053	95.6	protein tyrosin...	Homo sapiens
BAG58084	97.2	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000998	17	46	PF00629	MAM
	IPR013151	61	124	PF00047	Immunoglobulin
	IPR003961	143	229	PF00041	Fibronectin
	IPR003961	344	435	PF00041	Fibronectin
HMMSmart	IPR003599	53	141	SM00409	Immunoglobulin subtype
	IPR003961	143	226	SM00060	Fibronectin
	IPR003961	242	328	SM00060	Fibronectin
	IPR003961	344	432	SM00060	Fibronectin
ProfileScan	IPR000998	17	46	PS50060	MAM
	IPR007110	48	133	PS50835	Immunoglobulin-like
	IPR003961	143	235	PS50853	Fibronectin
	IPR003961	241	337	PS50853	Fibronectin
	IPR003961	342	441	PS50853	Fibronectin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	606	IAGISAGILVFILLLLVVILIV	627	PRIMARY	22