ORK06536

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06536

Order Kazusa clone(s) from :

Accession No	AB209729
Product ID	ORK06536
Clone name	bm05625
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	PTPRO
cDNA sequence	DNA sequence (2354 bp) Predicted protein sequence (743 aa)
Description	Receptor-type tyrosine-protein phosphatase O precursor (EC 3.1.3.48) (Glomerular epithelial protein 1) (Protein tyrosine phosphatase U2) (PTPase U2) (PTP-U2).

Features of the cloned cDNA sequence

Description

Length: 2354 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	0 bp
Genome contig ID	gi89161190f_15266598
PolyA signal sequence (None)	+--------+--------+----*----+---- TCTAGAATGCTTCACTGGATGGTGGTTGCAGAAGG
Flanking genome sequence (302548 - 302597)	----+--------+--------+--------+--------+----* AAAAAAGAAAATTAAAAAGAGTGTATGTTTCTTTGAATGCCAGCATTGTG

Features of the protein sequence

Description

Length: 743 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92966	100.0	receptor-type p...	Homo sapiens
AAA82892	100.0	glomerular epit...	Homo sapiens
AAI26202	100.0	Protein tyrosin...	Homo sapiens
BAF82473	99.8	unnamed protein...	Homo sapiens
XP_543791	91.0	similar to rece...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003961	503	591	PF00041	Fibronectin
HMMSmart	IPR003961	503	588	SM00060	Fibronectin
HMMSmart	IPR003961	600	686	SM00060	Fibronectin
ProfileScan	IPR003961	97	185	PS50853	Fibronectin
	IPR003961	399	487	PS50853	Fibronectin
	IPR003961	502	597	PS50853	Fibronectin
	IPR003961	600	700	PS50853	Fibronectin

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp