ORK06538

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06538

Order Kazusa clone(s) from :

Accession No	AB208855
Product ID	ORK06538
Clone name	fj15275
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PTPRU
cDNA sequence	DNA sequence (4872 bp) Predicted protein sequence (1243 aa)
Description	Receptor-type tyrosine-protein phosphatase U precursor (EC 3.1.3.48) (R-PTP-U) (Protein-tyrosine phosphatase J) (PTP-J) (Pancreatic carcinoma phosphatase 2) (PCP-2).

Features of the cloned cDNA sequence

Description

Length: 4872 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1138 bp
Genome contig ID	gi89161185f_29358566
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAGCGCTTTGTAAATAAACGTGCTCTCTGAATGCC
Flanking genome sequence (167334 - 167383)	----+--------+--------+--------+--------+----* ACAGAGCAGCCCTGTGTGTGTCTCACCAGCCTGACGGGGCCTGCTCACCT

Features of the protein sequence

Description

Length: 1243 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92092	100.0	Receptor protei...	Homo sapiens
CAH72393	100.0	protein tyrosin...	Homo sapiens
AAB51343	99.9	receptor protei...	Homo sapiens
AAB07074	99.8	receptor protei...	Homo sapiens
NP_573438	99.5	receptor-type t...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	739	746	PR00700	Protein-tyrosine phosphatase
	IPR000242	755	775	PR00700	Protein-tyrosine phosphatase
	IPR000242	838	855	PR00700	Protein-tyrosine phosphatase
	IPR000242	877	895	PR00700	Protein-tyrosine phosphatase
	IPR000242	908	923	PR00700	Protein-tyrosine phosphatase
	IPR000242	924	934	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR003961	93	178	PF00041	Fibronectin
	IPR003961	190	282	PF00041	Fibronectin
	IPR003961	293	386	PF00041	Fibronectin
	IPR000242	720	940	PF00102	Protein-tyrosine phosphatase
	IPR000242	1000	1235	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR003961	92	175	SM00060	Fibronectin
	IPR003961	191	279	SM00060	Fibronectin
	IPR003961	295	383	SM00060	Fibronectin
	IPR000242	690	943	SM00194	Protein-tyrosine phosphatase
	IPR003595	839	940	SM00404	Protein-tyrosine phosphatase
	IPR000242	972	1238	SM00194	Protein-tyrosine phosphatase
	IPR003595	1132	1235	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR003961	92	184	PS50853	Fibronectin
	IPR003961	190	288	PS50853	Fibronectin
	IPR003961	289	392	PS50853	Fibronectin
	IPR000242	714	941	PS50055	Protein-tyrosine phosphatase
	IPR000387	861	932	PS50056	Protein-tyrosine phosphatase
	IPR000242	973	1236	PS50055	Protein-tyrosine phosphatase
	IPR000387	1152	1227	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	880	892	PS00383	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	1175	1187	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	556	LGICAGGLAVLILLLGAIIVII	577	PRIMARY	22