ORK06569

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06569

Order Kazusa clone(s) from :

Accession No	AB209023
Product ID	ORK06569
Clone name	hg04315
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RABGGTB
cDNA sequence	DNA sequence (6685 bp) Predicted protein sequence (320 aa)
Description	Geranylgeranyl transferase type-2 subunit beta (EC 2.5.1.60) (Geranylgeranyl transferase type II subunit beta) (Rab geranylgeranyltransferase subunit beta) (Rab geranyl- geranyltransferase subunit beta) (Rab GG transferase beta) (Rab GGTase beta).

Features of the cloned cDNA sequence

Description

Length: 6685 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	5722 bp
Genome contig ID	gi89161185f_75925769
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTCAATATGTAGAAATAAAGCCATTTTTAATTG
Flanking genome sequence (113644 - 113693)	----+--------+--------+--------+--------+----* AAACATAGCCATTCTCATTTATTTATGTATTATCTATGACTGCTTTTCTA

Features of the protein sequence

Description

Length: 320 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92260	3.5e-150	100.0	Rab geranylgera...	Homo sapiens
P53611	1.6e-134	100.0	Geranylgeranyl ...	Homo sapiens
AAA91473	3.2e-134	99.6	geranylgeranyl ...	Homo sapiens
CAA69383	3.3e-133	99.2	rab geranylgera...	Homo sapiens
Q5E9B3	9e-133	98.2	Geranylgeranyl ...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001330	66	109	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	114	157	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	162	205	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	210	253	PF00432	Prenyltransferase/squalene oxidase
	IPR001330	258	290	PF00432	Prenyltransferase/squalene oxidase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp