ORK06591

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06591

Order Kazusa clone(s) from :

Accession No	AB209681
Product ID	ORK06591
Clone name	pf06711
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RAPGEF4
cDNA sequence	DNA sequence (6400 bp) Predicted protein sequence (643 aa)
Description	Rap guanine nucleotide exchange factor 4 (cAMP-regulated guanine nucleotide exchange factor II) (cAMP-GEFII) (Exchange factor directly activated by cAMP 2) (Epac 2).

Features of the cloned cDNA sequence

Description

Length: 6400 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1123 bp
Genome contig ID	gi89161199f_173208842
PolyA signal sequence (AATATA,-18)	+--------+--------+----*----+---- ATCTAGTATCTTCACTAAATATAATTGTCGACAAG
Flanking genome sequence (417024 - 417073)	----+--------+--------+--------+--------+----* AAATGGTTGTGTTCATCTCAATTCCTATAATATGAAAGGGGTAACCATTT

Features of the protein sequence

Description

Length: 643 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92918	100.0	RAP guanine-nuc...	Homo sapiens
NP_001093867	99.6	rap guanine nuc...	Homo sapiens
EAX11168	99.6	Rap guanine nuc...	Homo sapiens
Q8WZA2	99.6	Rap guanine nuc...	Homo sapiens
AAD03422	99.5	cAMP-regulated ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000595	16	94	PF00027	Cyclic nucleotide-binding
	IPR000651	131	237	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR000159	300	379	PF00788	Ras-association
	IPR001895	401	585	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000595	1	107	SM00100	Cyclic nucleotide-binding
	IPR000651	127	266	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	400	642	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000595	16	89	PS50042	Cyclic nucleotide-binding
	IPR000651	128	266	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	404	641	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	553	582	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	1	CASILIISLFIFLCLVFNQGE	21	PRIMARY	21