Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06596
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209789
Product ID ORK06596
Clone name bm02881
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RASAL2
cDNA sequence DNA sequence (1822 bp)
Predicted protein sequence (508 aa)
Description Ras GTPase-activating protein nGAP (RAS protein activator-like 1).
Features of the cloned cDNA sequence

Length: 1822 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 0 bp
Genome contig ID gi89161185f_176229579
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TCATAGTATCACAGTTCACATTTACAAGGATGTGG
Flanking genome sequence
(449078 - 449127)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAGAAAAAAAAGGACAAGAATAATTATGTAGGGCTAGTCAACATC

Features of the protein sequence

Length: 508 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD93026 9.2e-172 100.0 Hypothetical pr...
Homo sapiens
EAW91017 9.7e-125 100.0 RAS protein act...
Homo sapiens
XP_001153876 3.5e-124 99.4 RAS protein act...
Pan troglodytes
XP_514024 3.5e-124 99.4 RAS protein act...
Pan troglodytes
XP_001154188 3.6e-124 99.4 RAS protein act...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000008 444 505 PF00168 C2 calcium-dependent membrane targeting
HMMSmart IPR001849 183 433 SM00233 Pleckstrin-like
ProfileScan IPR001849 200 431 PS50003 Pleckstrin-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp