Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06599
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209446
Product ID ORK06599
Clone name pj02638
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RASSF4
cDNA sequence DNA sequence (4350 bp)
Predicted protein sequence (412 aa)
Description Ras association domain-containing protein 4.
Features of the cloned cDNA sequence

Length: 4350 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1378 bp
Genome contig ID gi89161187f_44674861
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
GATCCTTAGGTGCTCAATAAAGGTGTGCTGTATTG
Flanking genome sequence
(135302 - 135351)
----+----*----+----*----+----*----+----*----+----*
AACTGAAGAAGTGAGAACCAAGCTTTTTTTTTTTTTTTTGCTTTCTGTGC

Features of the protein sequence

Length: 412 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92683 1.5e-165 100.0 Ras association...
Homo sapiens
Q9H2L5 9.6e-115 98.6 Ras association...
Homo sapiens
AAG44666 2e-114 98.3 AD037 [Homo sap...
Homo sapiens
XP_507760 1.7e-113 97.3 Ras association...
Pan troglodytes
XP_001101344 4.4e-112 96.3 similar to Ras ...
Macaca mulatta
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000159 265 353 PF00788 Ras-association
HMMSmart IPR000159 263 353 SM00314 Ras-association
ProfileScan IPR000159 265 353 PS50200 Ras-association
IPR011524 361 408 PS50951 SARAH
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp