ORK06603

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06603

Order Kazusa clone(s) from :

Accession No	AB209007
Product ID	ORK06603
Clone name	hg00916
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RBM14
cDNA sequence	DNA sequence (6303 bp) Predicted protein sequence (552 aa)
Description	RNA-binding protein 14 (RNA-binding motif protein 14) (RRM-containing coactivator activator/modulator) (Synaptotagmin-interacting protein) (SYT-interacting protein).

Features of the cloned cDNA sequence

Description

Length: 6303 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1607 bp
Genome contig ID	gi51511727f_66045217
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- ACTACAAATAAAACTTGGGGCAATTTGCAGTTTGG
Flanking genome sequence (106172 - 106221)	----+--------+--------+--------+--------+----* AAACCTGGTTGTCATTGTCTTGATTGCATTCAGTGTCAAAGGAGCCAATT

Features of the protein sequence

Description

Length: 552 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92244	2.7e-147	100.0	RNA binding mot...	Homo sapiens
EAW74553	8.6e-134	99.6	RNA binding mot...	Homo sapiens
XP_001172363	1.3e-133	99.4	RNA binding mot...	Pan troglodytes
XP_001109150	3.1e-132	98.8	RNA binding mot...	Macaca mulatta
AAH10294	5e-131	97.4	Rbm14 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	48	78	PF00076	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp