Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06604
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209680
Product ID ORK06604
Clone name pf07304
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RBM15
cDNA sequence DNA sequence (7612 bp)
Predicted protein sequence (316 aa)
Description Putative RNA-binding protein 15 (RNA-binding motif protein 15) (One- twenty two protein).
Features of the cloned cDNA sequence

Length: 7612 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6661 bp
Genome contig ID gi89161185f_110585474
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ATGCAAAATTAGGTGAAATAAAACCTGGATGAAAT
Flanking genome sequence
(125545 - 125594)
----+----*----+----*----+----*----+----*----+----*
AATTGTTGTAAATTTGTTTCTCCCAGTCATATTTGATCATTGAGATATTT

Features of the protein sequence

Length: 316 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92917 5.8e-110 100.0 RNA binding mot...
Homo sapiens
BAB15185 8.6e-110 100.0 unnamed protein...
Homo sapiens
CAC38861 1.3e-109 100.0 one twenty two ...
Homo sapiens
DAA05818 4.9e-109 99.6 TPA_exp: RNA bi...
Homo sapiens
AAX32703 5e-109 100.0 RNA binding mot...
synthetic construct
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR012921 147 283 PF07744 Spen paralogue and orthologue C-terminal
ProfileScan IPR010912 136 315 PS50917 Spen paralogue and orthologue C-terminal
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp