Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06609
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209753
Product ID ORK06609
Clone name bg00175
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RBM7
cDNA sequence DNA sequence (6706 bp)
Predicted protein sequence (155 aa)
Description RNA-binding protein 7 (RNA-binding motif protein 7).
Features of the cloned cDNA sequence

Length: 6706 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 6215 bp
Genome contig ID gi51511727f_113676566
PolyA signal sequence
(AAGAAA,-11)
+----*----+----*----+----*----+----
TATATATAATACTTAAGAAAAAAAAAGAAAAAAAA
Flanking genome sequence
(111386 - 111435)
----+----*----+----*----+----*----+----*----+----*
TCTTACTATTTACCCCCATAGTTACCATTTCTGGAGCTCCTCATTCCTTT

Features of the protein sequence

Length: 155 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92990 1e-60 100.0 Hypothetical pr...
Homo sapiens
XP_508767 8e-58 100.0 hypothetical pr...
Pan troglodytes
XP_001087792 4.5e-57 99.3 RNA binding mot...
Macaca mulatta
EAW67248 8.4e-57 99.3 RNA binding mot...
Homo sapiens
XP_001151010 8.4e-57 99.3 hypothetical pr...
Pan troglodytes
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR000504 18 88 PF00076 RNA recognition motif
HMMSmart IPR000504 17 89 SM00360 RNA recognition motif
ProfileScan IPR000504 16 93 PS50102 RNA recognition motif
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp