Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06616
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209222
Product ID ORK06616
Clone name fj13051
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RCBTB1
cDNA sequence DNA sequence (4163 bp)
Predicted protein sequence (194 aa)
Description RCC1 and BTB domain-containing protein 1 (Regulator of chromosome condensation and BTB domain-containing protein 1) (Chronic lymphocytic leukemia deletion region gene 7 protein) (CLL deletion region gene 7 protein).
Features of the cloned cDNA sequence

Length: 4163 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 2177 bp
Genome contig ID gi51511729r_48904082
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
GACATGTTAATAAACAAAGTAACATTAAAACAGGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACATAGAGTTGTTTTTTTCCTTCAAAATCAGTAGTCTGCAGCCTTAAAAA

Features of the protein sequence

Length: 194 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92459 1.5e-86 100.0 regulator of ch...
Homo sapiens
XP_855669 8.2e-82 96.8 similar to regu...
Canis lupus fam...
BAA91768 5e-81 98.9 unnamed protein...
Homo sapiens
BAG52232 5.5e-81 98.9 unnamed protein...
Homo sapiens
AAK38372 9.7e-81 98.9 CLLL7 protein [...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013069 23 130 PF00651 BTB/POZ
IPR013069 133 162 PF00651 BTB/POZ
HMMSmart IPR000210 33 130 SM00225 BTB/POZ-like
ProfileScan IPR000210 33 100 PS50097 BTB/POZ-like
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp