Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK06617
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209543
Product ID ORK06617
Clone name fk11515
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol RCBTB2
cDNA sequence DNA sequence (2955 bp)
Predicted protein sequence (556 aa)
Description RCC1 and BTB domain-containing protein 2 (Regulator of chromosome condensation and BTB domain-containing protein 2) (Chromosome condensation 1-like) (CHC1-L) (RCC1-like G exchanging factor).
Features of the cloned cDNA sequence

Length: 2955 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1146 bp
Genome contig ID gi51511729r_47861102
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TATTTGGTAATAAAGTGCTTATTTGCAGATAACAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACAAATGTGTTGGGGTTTTTTTTAATCCCAAAACAGCAGCAAAATTATA

Features of the protein sequence

Length: 556 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92780 0 100.0 RCC1-like G exc...
Homo sapiens
Q5RCZ7 0 99.8 RCC1 and BTB do...
Pongo abelii
BAG63022 0 99.8 unnamed protein...
Homo sapiens
BAG51149 0 99.4 unnamed protein...
Homo sapiens
CAH91921 0 99.8 hypothetical pr...
Pongo abelii
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR000408 124 140 PR00633 Regulator of chromosome condensation
IPR000408 159 172 PR00633 Regulator of chromosome condensation
IPR000408 178 194 PR00633 Regulator of chromosome condensation
IPR000408 229 245 PR00633 Regulator of chromosome condensation
IPR000408 267 283 PR00633 Regulator of chromosome condensation
IPR000408 283 297 PR00633 Regulator of chromosome condensation
HMMPfam IPR000408 122 172 PF00415 Regulator of chromosome condensation
IPR000408 175 225 PF00415 Regulator of chromosome condensation
IPR000408 228 277 PF00415 Regulator of chromosome condensation
IPR000408 280 329 PF00415 Regulator of chromosome condensation
IPR013069 389 492 PF00651 BTB/POZ
IPR013069 494 524 PF00651 BTB/POZ
HMMSmart IPR000210 399 492 SM00225 BTB/POZ-like
ProfileScan IPR000408 123 175 PS50012 Regulator of chromosome condensation
IPR000408 176 228 PS50012 Regulator of chromosome condensation
IPR000408 229 280 PS50012 Regulator of chromosome condensation
IPR000408 281 332 PS50012 Regulator of chromosome condensation
IPR000210 399 462 PS50097 BTB/POZ-like
ScanRegExp IPR000408 162 172 PS00626 Regulator of chromosome condensation
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp