ORK06617

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06617

Order Kazusa clone(s) from :

Accession No	AB209543
Product ID	ORK06617
Clone name	fk11515
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RCBTB2
cDNA sequence	DNA sequence (2955 bp) Predicted protein sequence (556 aa)
Description	RCC1 and BTB domain-containing protein 2 (Regulator of chromosome condensation and BTB domain-containing protein 2) (Chromosome condensation 1-like) (CHC1-L) (RCC1-like G exchanging factor).

Features of the cloned cDNA sequence

Description

Length: 2955 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1146 bp
Genome contig ID	gi51511729r_47861102
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TATTTGGTAATAAAGTGCTTATTTGCAGATAACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACAAATGTGTTGGGGTTTTTTTTAATCCCAAAACAGCAGCAAAATTATA

Features of the protein sequence

Description

Length: 556 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92780	100.0	RCC1-like G exc...	Homo sapiens
Q5RCZ7	99.8	RCC1 and BTB do...	Pongo abelii
BAG63022	99.8	unnamed protein...	Homo sapiens
BAG51149	99.4	unnamed protein...	Homo sapiens
CAH91921	99.8	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000408	124	140	PR00633	Regulator of chromosome condensation
	IPR000408	159	172	PR00633	Regulator of chromosome condensation
	IPR000408	178	194	PR00633	Regulator of chromosome condensation
	IPR000408	229	245	PR00633	Regulator of chromosome condensation
	IPR000408	267	283	PR00633	Regulator of chromosome condensation
	IPR000408	283	297	PR00633	Regulator of chromosome condensation
HMMPfam	IPR000408	122	172	PF00415	Regulator of chromosome condensation
	IPR000408	175	225	PF00415	Regulator of chromosome condensation
	IPR000408	228	277	PF00415	Regulator of chromosome condensation
	IPR000408	280	329	PF00415	Regulator of chromosome condensation
	IPR013069	389	492	PF00651	BTB/POZ
	IPR013069	494	524	PF00651	BTB/POZ
HMMSmart	IPR000210	399	492	SM00225	BTB/POZ-like
ProfileScan	IPR000408	123	175	PS50012	Regulator of chromosome condensation
	IPR000408	176	228	PS50012	Regulator of chromosome condensation
	IPR000408	229	280	PS50012	Regulator of chromosome condensation
	IPR000408	281	332	PS50012	Regulator of chromosome condensation
	IPR000210	399	462	PS50097	BTB/POZ-like
ScanRegExp	IPR000408	162	172	PS00626	Regulator of chromosome condensation

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp